Question:
Which of the following DNA, in its double-stranded form, will have the highest \(T_m\)?
Which of the following DNA, in its double-stranded form, will have the highest \(T_m\)?
Show Hint
• More GC → Higher \(T_m\)
• Rule: GC-rich sequences melt at higher temperature
Updated On: May 13, 2026
- ATGTTGGACCTTGAGTAATGCTA
- AAAGGATTTCCCTTTGATCGTATG
- ATTTTACTAGATTACTAGTATTGATA
- GCTTATGTATACCGGTTAGATCG
Show Solution
Verified By Collegedunia
The Correct Option is D
Solution and Explanation
Concept:
Melting temperature (\(T_m\)) of DNA depends on:
• GC content (higher GC → higher \(T_m\))
• Length of DNA
• Base stacking interactions
Step 1: Understanding base pair stability.
• G–C pairs → 3 hydrogen bonds → More stable
• A–T pairs → 2 hydrogen bonds → Less stable
Step 2: Comparing GC content.
• (A), (B), (C): Relatively lower GC content.
• (D): Higher proportion of G and C bases → highest stability.
Step 3: Selecting the correct answer.
Since higher GC content leads to higher \(T_m\), option (D) has the highest melting temperature.
• GC content (higher GC → higher \(T_m\))
• Length of DNA
• Base stacking interactions
Step 1: Understanding base pair stability.
• G–C pairs → 3 hydrogen bonds → More stable
• A–T pairs → 2 hydrogen bonds → Less stable
Step 2: Comparing GC content.
• (A), (B), (C): Relatively lower GC content.
• (D): Higher proportion of G and C bases → highest stability.
Step 3: Selecting the correct answer.
Since higher GC content leads to higher \(T_m\), option (D) has the highest melting temperature.
Was this answer helpful?
0
0
Top GAT B Biotechnology Tools and Techniques Questions
- The microscope which uses lasers to scan the specimen at a specific depth, illuminates one area at a time and blocks stray light to give an image with excellent contrast and resolution is
- Which one of the following is NOT true for Quantum dots as fluorescent probes in fluorescence microscopy?
Given below are two statements:
Statement I: Precision refers to the closeness of various measurements for the same quantity.
Statement II: Accuracy is the agreement of the obtained value with the known or true value of the quantity.
In light of the above statements, choose the correct answer from the options given below:- Which one of the following statements correctly describes type IIP restriction enzymes?
A. They cut nucleotides only from the ends of the DNA.
B. They act on only palindromic nucleotide sequences in the DNA.
C. They recognize only GC rich sequences.
D. They recognize only AT rich sequences. - Which one of the following techniques can be used to determine the copy number of a gene?
View More Questions
Top GAT B Molecular Biology Questions
- Which one of the following statements correctly describes type IIP restriction enzymes?
A. They cut nucleotides only from the ends of the DNA.
B. They act on only palindromic nucleotide sequences in the DNA.
C. They recognize only GC rich sequences.
D. They recognize only AT rich sequences. - Which one of the following techniques can be used to determine the copy number of a gene?
- Which enzyme catalyzes strand separation at the replication fork?
- Given below are two statements:
Statement I: The fragments of DNA generated after cleavage with a restriction enzyme have a phosphate group on their 3' ends and a -OH group on their 5' ends.
Statement II: Cohesive ends generated by restriction digestion reanneal with complementary DNA fragment. - Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R.
Assertion A: A linear DNA molecule containing three recognition sites for a restriction enzyme will generate multiple DNA fragments on partial digestion.
Reason R: Partial digestion by restriction enzymes leads to a heterogeneous population of DNA fragments.
View More Questions
Top GAT B Questions
- Which one of the following modifications is NOT a natural N-terminal modification of proteins?
- Bacillus thuringiensis CryA controls certain caterpillar pests by
- Respiratory pathway is considered as a ________ pathway
- Many enzymes catalyze both forward and reverse reactions. Which one of the following statement is NOT correct?
- Which law of thermodynamics states that "energy of an isolated system is constant"?
View More Questions