Many ribosomes may associate with a single $mRNA$ to form multiple copies of a polypeptide simultaneously. Such strings of ribosomes are termed as
- Nucleosome
- Polysome
- Plastidome
- Polyhedral bodies
The Correct Option is B
Solution and Explanation
To understand the given question, we need to delve into the concept of ribosomes interacting with mRNA during the process of protein synthesis. When a single mRNA strand is translated, multiple ribosomes can attach to it, forming a complex known as a "polysome" or "polyribosome". Let's explore why this is the correct option and rule out the others:
- Polysome: This is the correct answer. A polysome is a cluster of ribosomes bound to an mRNA molecule, allowing the simultaneous synthesis of multiple copies of a polypeptide. This is efficient for cells, as it speeds up protein production.
- Nucleosome: This term refers to a segment of DNA wound around a core of histone proteins, which is involved in the structural organization of chromosomes. It is unrelated to mRNA translation or ribosomes.
- Plastidome: This is not a commonly used term in molecular biology. It may be confused with plastids, which are components of plant cells involved in processes like photosynthesis, but they have no direct role in mRNA translation.
- Polyhedral bodies: These are viral inclusion bodies found within certain infectious entities, like bacteria or other cells. They are unrelated to the process of translating mRNA with ribosomes.
Hence, the strings of ribosomes assembling on a single mRNA strand to synthesize multiple polypeptide copies are correctly termed "polysomes".
Top NEET Biology Questions
- Chordae tendineae are found in
- Glycolysis takes place in
- All the components of the nodal tissue are autoexcitable. Why does the SA node act as the normal pacemakar?
- All vertebrates are chordates but all chordates are not vertebrates, why ?
- The blood calcium level is lowered by the deficiency of
Top NEET Transcription Questions
- Read the following four statements (A - D). (A) In transcription, adenosine pairs with uracil. (B) Regulation of lac operon by repressor is referred to as positive regulation. (C) The human genome has approximately 50,000 genes. (D) Haemophilia is a sex-linked recessive disease. How many of the above statements are right?
- Name the enzyme that facilitates opening of DNA helix during transcription.
- The equivalent of a structural gene is -
- A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;
- Which one is the correct product of DNA dependent RNA polymerase to the given template?
3’TACATGGCAAATATCCATTCA5’
Top NEET Questions
- A coil of inductive reactance $31\, \Omega$ has a resistance of 8 $\Omega$. It is placed in series with a condenser of capacitative reactance $25 \,\Omega$. The combination is connected to an a.c. source of 110 V. The power factor of the circuit is :-
- A liquid compound (x) can be purified by steam distillation only if it is
- In an a.c. circuit with phase voltage V and current I, the power dissipated is
- A bubble in glass slab $ (\mu = 1.5) $ when viewed from one side appears at 5 cm and 2 cm from other side, then thickness of slab is
- A bulb is located on a wall. Its image is to be obtained on a parallel wall with the help of convex lens. If the distance between parallel walls is 'd' then required focal length of lens placed in between the walls is : -
Concepts Used:
Transcription
The very first stage of gene expression is the procedure of transcription. In this procedure, mRNA is the place where the genetic information is stored which later aids in encoding a protein. In this process, the DNA strand acts as a guide in the making of mRNA. Despite the fact that there is one exception which is adenine base pairs with uracil instead of thymine.
Transcription Unit:
The transcription unit is a set of freshly combined RNA molecules that have been transcribed from DNA. The cause is to encode at least one gene. A protein that has been encoded or encrypted with a DNA transcription unit may have a coding sequence. Transcription has a lower copying fidelity rate when differentiated from DNA replication.
The Stages of Transcription:
The procedure of transcription is enzymatically catalyzed into three steps:
- Initiation
- Elongation
- Termination