| DNA | - | T | A | C | A | T | G | G | C | A | A | A | T | A | T | C | C | A | T | T | C | A |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| RNA | - | A | U | G | U | A | C | C | G | U | U | U | A | U | A | G | G | U | A | A | G | U |
DNA-dependent RNA polymerase transcribes the template strand of DNA to RNA. In this case, the RNA sequence will be complementary to the given DNA template:
Given DNA template strand (3' → 5'): TACATGGCAAATATCCATTCA
Transcribed RNA strand (5' → 3'): AUGUACCGUUUAUAGGUAAGU
Thus, the correct answer is (1) 5'AUGUACCGUUUAUAGGUAAGU3'.
| List I | List II |
|---|---|
| A. The Evil Quartet | III. Causes of biodiversity losses |
| B. Ex situ conservation | I. Cryopreservation |
| C. Lantana camara | II. Alien species invasion |
| D. Dodo | IV. Extinction |

A constant voltage of 50 V is maintained between the points A and B of the circuit shown in the figure. The current through the branch CD of the circuit is :
| List I | List II |
|---|---|
| A. The Evil Quartet | III. Causes of biodiversity losses |
| B. Ex situ conservation | I. Cryopreservation |
| C. Lantana camara | II. Alien species invasion |
| D. Dodo | IV. Extinction |