Question:
Which one is the correct product of DNA dependent RNA polymerase to the given template?
3’TACATGGCAAATATCCATTCA5’
Which one is the correct product of DNA dependent RNA polymerase to the given template?
3’TACATGGCAAATATCCATTCA5’
3’TACATGGCAAATATCCATTCA5’
Updated On: Mar 19, 2026
- 5’AUGUACCGUUUAUAGGUAAGU3’
- 5’AUGUAAAGUUUAUAGGUAAGU3’
- 5’AUGUACCGUUUAUAGGGAAGU3’
- 5’ATGTACCGTTTATAGGTAAGT3’
Show Solution
Verified By Collegedunia
The Correct Option is A
Approach Solution - 1
To determine the correct product of DNA-dependent RNA polymerase, we need to perform transcription on the provided DNA template strand. The given DNA template is:
3’TACATGGCAAATATCCATTCA5’.
During transcription, complementary base pairing rules apply: adenine (A) pairs with uracil (U) in RNA (replacing thymine (T) in DNA), thymine (T) pairs with adenine (A), cytosine (C) pairs with guanine (G), and guanine (G) pairs with cytosine (C).
Following these base pairing rules, the mRNA sequence produced from the 3’ to 5’ DNA strand will be transcribed as follows:
3’TACATGGCAAATATCCATTCA5’.
During transcription, complementary base pairing rules apply: adenine (A) pairs with uracil (U) in RNA (replacing thymine (T) in DNA), thymine (T) pairs with adenine (A), cytosine (C) pairs with guanine (G), and guanine (G) pairs with cytosine (C).
Following these base pairing rules, the mRNA sequence produced from the 3’ to 5’ DNA strand will be transcribed as follows:
| DNA | - | T | A | C | A | T | G | G | C | A | A | A | T | A | T | C | C | A | T | T | C | A |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| RNA | - | A | U | G | U | A | C | C | G | U | U | U | A | U | A | G | G | U | A | A | G | U |
The transcribed RNA sequence is: 5'AUGUACCGUUUAUAGGUAAGU3'.
Thus, the correct product of the DNA-dependent RNA polymerase for the given template is the sequence that matches the options given as 5'AUGUACCGUUUAUAGGUAAGU3'.
Thus, the correct product of the DNA-dependent RNA polymerase for the given template is the sequence that matches the options given as 5'AUGUACCGUUUAUAGGUAAGU3'.
Was this answer helpful?
8
1
Show Solution
Verified By Collegedunia
Approach Solution -2
DNA-dependent RNA polymerase transcribes the template strand of DNA to RNA. In this case, the RNA sequence will be complementary to the given DNA template:
Given DNA template strand (3' → 5'): TACATGGCAAATATCCATTCA
Transcribed RNA strand (5' → 3'): AUGUACCGUUUAUAGGUAAGU
Thus, the correct answer is (1) 5'AUGUACCGUUUAUAGGUAAGU3'.
Was this answer helpful?
1
0
Top NEET Biology Questions
- Chordae tendineae are found in
- Glycolysis takes place in
- All the components of the nodal tissue are autoexcitable. Why does the SA node act as the normal pacemakar?
- All vertebrates are chordates but all chordates are not vertebrates, why ?
- The blood calcium level is lowered by the deficiency of
View More Questions
Top NEET Transcription Questions
- Read the following four statements (A - D). (A) In transcription, adenosine pairs with uracil. (B) Regulation of lac operon by repressor is referred to as positive regulation. (C) The human genome has approximately 50,000 genes. (D) Haemophilia is a sex-linked recessive disease. How many of the above statements are right?
- Name the enzyme that facilitates opening of DNA helix during transcription.
- Many ribosomes may associate with a single $mRNA$ to form multiple copies of a polypeptide simultaneously. Such strings of ribosomes are termed as
- The equivalent of a structural gene is -
- A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;
View More Questions
Top NEET Questions
- A coil of inductive reactance $31\, \Omega$ has a resistance of 8 $\Omega$. It is placed in series with a condenser of capacitative reactance $25 \,\Omega$. The combination is connected to an a.c. source of 110 V. The power factor of the circuit is :-
- A liquid compound (x) can be purified by steam distillation only if it is
- In an a.c. circuit with phase voltage V and current I, the power dissipated is
- A bubble in glass slab $ (\mu = 1.5) $ when viewed from one side appears at 5 cm and 2 cm from other side, then thickness of slab is
- A bulb is located on a wall. Its image is to be obtained on a parallel wall with the help of convex lens. If the distance between parallel walls is 'd' then required focal length of lens placed in between the walls is : -
View More Questions