Name the enzyme that facilitates opening of DNA helix during transcription.
- DNA ligase
- DNA helicase
- DNA polymerase
- RNA polymerase
The Correct Option is D
Solution and Explanation
Top NEET Biology Questions
- The chronological order of human evolution from early to the recent is
- Upper part of sea/aquatic ecosystem contains
- Where is respiratory electron transport system (ETS) located in plants ?
- Which among the following are the smallest living cells, known without a definite cell wall, pathogenic to plants as well as animals and can survive without oxygen ?
- Three of the following pairs of the human skeletal parts are correctly matched with their respective inclusive skeletal category and one pair is not matched. Identify the non-matching pair. .
Pair of skeletal parts Category (a)$\,\,$ Sternum and ribs$\,\,$ Axial skeleton (b)$\,\,$ Clavicle and glenoid cavity$\,\,$ Pelvic girdle (c)$\,\,$ Flumerus and ulna$\,\,$ Appendicular skeleton (d)$\,\,$ Malleus and stapes$\,\,$ Ear ossicles
Top NEET Transcription Questions
- A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;
- Which one is the correct product of DNA dependent RNA polymerase to the given template?
3тАЩTACATGGCAAATATCCATTCA5тАЩ - Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5тАЩAUCGAUCGAUCGAUCGAUCGAUCG AUCG 3тАЩ?
- Identify the correct statement.
рдЕрдиреБрд▓реЗрдЦрди (рдЯреНрд░рд╛рдВрд╕рдХреНрд░рд┐рдкреНрд╢рди) рдЗрдХрд╛рдИ рдХреЗ рд╕рдВрджрд░реНрдн рдореЗрдВ рдирд┐рдореНрдирд▓рд┐рдЦрд┐рдд рдореЗрдВ рд╕реЗ рдХреМрди-рд╕реЗ рдХрдерди рд╕рд╣реА рд╣реИрдВ?
A. рдбреАрдПрдирдП рдореЗрдВ рдЕрдиреБрд▓реЗрдЦрди рдЗрдХрд╛рдИ рдХреЗ рдореБрдЦреНрдпрддрдпрд╛ рддреАрди рднрд╛рдЧ : рдЙрдиреНрдирд╛рдпрдХ, рд╕рдВрд░рдЪрдирд╛рддреНрдордХ рдЬреАрди рдФрд░ рд╕рдорд╛рдкрдХ рд╣реЛрддреЗ рд╣реИрдВред
B. рдХрд╣рд╛ рдЬрд╛рддрд╛ рд╣реИ рдХрд┐ рдЙрдиреНрдирд╛рдпрдХ, рд╕рдВрд░рдЪрдирд╛рддреНрдордХ рдЬреАрди рдХреЗ 5'-рд╕рд┐рд░реЗ рдХреА рдУрд░ рд╕реНрдерд┐рдд рд╣реЛрддрд╛ рд╣реИред
C. рдЙрдиреНрдирд╛рдпрдХ рдПрдХ рдбреАрдПрдирдП рдЕрдиреБрдХреНрд░рдо рд╣реИ рдЬреЛ рдЖрд░рдПрдирдП рдкреЙрд▓рд┐рдорд░реЗрдЬ рдХреЗ рд▓рд┐рдП рдмрдВрдзрди рд╕реНрдерд▓ рдкреНрд░рджрд╛рди рдХрд░рддрд╛ рд╣реИред
D. рдЙрдиреНрдирд╛рдпрдХ рдЯреЗрдореНрдкрд▓реЗрдЯ рдФрд░ рдХреВрдЯрд▓реЗрдЦрди рд░рдЬреНрдЬреБрдХ рдХреЛ рдкрд░рд┐рднрд╛рд╖рд┐рдд рдХрд░рддрд╛ рд╣реИред
E. рд╕рдорд╛рдкрдХ, рдХреВрдЯрд▓реЗрдЦрди рд░рдЬреНрдЬреБрдХ рдХреЗ 3'-рд╕рд┐рд░реЗ рдХреА рдУрд░ рд╕реНрдерд┐рдд рд╣реЛрддрд╛ рд╣реИ рдФрд░ рдпрд╣ рдЕрдиреБрд▓реЗрдЦрди рдкреНрд░рдХреНрд░рд┐рдпрд╛ рдХреЗ рд╕рдорд╛рдкрди рдХреЛ рдкрд░рд┐рднрд╛рд╖рд┐рдд рдХрд░рддрд╛ рд╣реИред
рдиреАрдЪреЗ рджрд┐рдП рдЧрдП рд╡рд┐рдХрд▓реНрдкреЛрдВ рдореЗрдВ рд╕реЗ рд╕рд╣реА рдЙрддреНрддрд░ рдХрд╛ рдЪрдпрди рдХреАрдЬрд┐рдП :
Top NEET Questions
- A $100.0\, mL$ dilute solution of $Ag ^{+}$is electrolysed for $15.0$ minutes with a current of $1.25 \,mA$ and the silver is removed completely. What was the initial $\left[ Ag ^{+}\right]$?
- The time constant of C-R circuit is
- The chronological order of human evolution from early to the recent is
- The correct Boolean operation represented by the circuit diagram drawn is :
- The driver of a car travelling with speed $30\, m/sec$ towards a hill sounds a horn of frequency $600\, Hz.$ If the velocity of sound in air is $330\, m/s,$ the frequency of reflected sound as heard by driver is
Concepts Used:
Transcription
The very first stage of gene expression is the procedure of transcription. In this procedure, mRNA is the place where the genetic information is stored which later aids in encoding a protein. In this process, the DNA strand acts as a guide in the making of mRNA. Despite the fact that there is one exception which is adenine base pairs with uracil instead of thymine.
Transcription Unit:
The transcription unit is a set of freshly combined RNA molecules that have been transcribed from DNA. The cause is to encode at least one gene. A protein that has been encoded or encrypted with a DNA transcription unit may have a coding sequence. Transcription has a lower copying fidelity rate when differentiated from DNA replication.
The Stages of Transcription:
The procedure of transcription is enzymatically catalyzed into three steps:
- Initiation
- Elongation
- Termination