If the sequence of one strand of DNA is written as follows:
5'-ATGCATGCATGCATGCATGCATGCATGC-3'
Write down the sequence of complementary strand in 5'→3' direction
If the sequence of one strand of DNA is written as follows:
5'-ATGCATGCATGCATGCATGCATGCATGC-3'
Write down the sequence of complementary strand in 5'→3' direction
Solution and Explanation
The DNA strands are complementary to each other with respect to base sequence. Hence, if the sequence of one strand of DNA is
5'- ATGCATGCATGCATGCATGCATGCATGC − 3’
Then, the sequence of complementary strand in 5' to 3' direction will be
3'- TACGTACGTACGTACGTACGTACGTACG − 5’
Therefore, the sequence of nucleotides on DNA polypeptide in 5' to 3' direction is
5'- GCATGCATGCATGCATGCATGCATGCAT− 3’
Top CBSE CLASS XII Biology Questions
- Assertion (A): The embryo with 8 to 16 blastomeres is called a morula.
Reason (R): The morula continues to divide and transform into trophoblast.
- CBSE Class XII - 2026
- Biology
- The Female Reproductive System
- Monascus purpureus is a yeast used commercially in the production of which one of the following?
- CBSE Class XII - 2026
- Biology
- Microbiology
- The foetal ejection reflex in human triggers the release of _______ hormone from _______
- CBSE Class XII - 2026
- Biology
- General Physiology
- A DNA molecule is 160 base pairs long. It has 30% Guanine. How many Adenine bases are present in this DNA molecule?
- Assertion (A): Repetitive sequences make up a very large portion of human genome.
Reason (R): Repetitive sequences do not have direct coding functions in the genome.
Top CBSE CLASS XII Molecular Basis of Inheritance Questions
- Given below is a stretch of DNA showing the coding strand of structural gene of transcription unit.
5' - ATG ACC GTA TTT TCT GTA GTG CCC GTA CTT CAG GCA TTA 3'
(i) Write the corresponding template strand and m-RNA strand that will be transcribed along with its polarity.
(ii) If GUA of transcribed mRNA is an intron, then depict the sequence involved in formation of mRNA / mature / processed hnRNA strand :
(1) In a bacterium
(2) In humans
(iii) How many amino acids the resulting polypeptide will have after the process of translation in humans?
- CBSE Class XII - 2026
- Biology
- Molecular Basis of Inheritance
- Write down the salient features of double helix structure of DNA (any three points).
- CBSE Class XII - 2026
- Biology
- Molecular Basis of Inheritance
- Watson and Crick's discovery of DNA structure was based on which two findings. Also mention the name of scientists associated with these findings.
- CBSE Class XII - 2026
- Biology
- Molecular Basis of Inheritance
- Name the two types of bonds present within a single nucleotide.
- CBSE Class XII - 2026
- Biology
- Molecular Basis of Inheritance
- Differentiate between a DNA and RNA nucleotide.
- CBSE Class XII - 2026
- Biology
- Molecular Basis of Inheritance
Top CBSE CLASS XII Questions
In an economy, when __________ is insufficient to achieve the level of output corresponding to the full employment, the difference is termed a deflationary gap.
- CBSE Class XII - 2026
- Income and Expenditure Account
In an economy, the currency held by the public, Net Demand Deposits with Commercial Banks and Net Time Deposits with Commercial Banks stand at ₹ 1,42,000 crore, ₹ 22,000 crore and ₹ 86,000 crore respectively. The value of Money Supply (M1) would be ₹ _______ crore.
- CBSE Class XII - 2026
- Money and Banking
- The rate for the following reaction is given by: \[ A + B \rightarrow C, \quad \text{Rate} = k[A][B]^2 \] How is the rate affected if we double the concentration of B?
- CBSE Class XII - 2026
- Chemical Kinetics
- A circular coil of 100 turns and radius \( \left(\frac{10}{\sqrt{\pi}}\right) \, \text{cm}\) carrying current of \( 5.0 \, \text{A} \) is suspended vertically in a uniform horizontal magnetic field of \( 2.0 \, \text{T} \). The field makes an angle \( 30^\circ \) with the normal to the coil. Calculate:
the magnetic dipole moment of the coil, and
the magnitude of the counter torque that must be applied to prevent the coil from turning.- CBSE Class XII - 2026
- The Magnetic Dipole Moment
- Assertion (A): The embryo with 8 to 16 blastomeres is called a morula.
Reason (R): The morula continues to divide and transform into trophoblast.
- CBSE Class XII - 2026
- The Female Reproductive System
Concepts Used:
Transcription
The very first stage of gene expression is the procedure of transcription. In this procedure, mRNA is the place where the genetic information is stored which later aids in encoding a protein. In this process, the DNA strand acts as a guide in the making of mRNA. Despite the fact that there is one exception which is adenine base pairs with uracil instead of thymine.
Transcription Unit:
The transcription unit is a set of freshly combined RNA molecules that have been transcribed from DNA. The cause is to encode at least one gene. A protein that has been encoded or encrypted with a DNA transcription unit may have a coding sequence. Transcription has a lower copying fidelity rate when differentiated from DNA replication.
The Stages of Transcription:
The procedure of transcription is enzymatically catalyzed into three steps:
- Initiation
- Elongation
- Termination