If the sequence of one strand of DNA is written as follows:
5'-ATGCATGCATGCATGCATGCATGCATGC-3'
Write down the sequence of complementary strand in 5'→3' direction
If the sequence of one strand of DNA is written as follows:
5'-ATGCATGCATGCATGCATGCATGCATGC-3'
Write down the sequence of complementary strand in 5'→3' direction
Solution and Explanation
The DNA strands are complementary to each other with respect to base sequence. Hence, if the sequence of one strand of DNA is
5'- ATGCATGCATGCATGCATGCATGCATGC − 3’
Then, the sequence of complementary strand in 5' to 3' direction will be
3'- TACGTACGTACGTACGTACGTACGTACG − 5’
Therefore, the sequence of nucleotides on DNA polypeptide in 5' to 3' direction is
5'- GCATGCATGCATGCATGCATGCATGCAT− 3’
Top CBSE CLASS XII Biology Questions
- All algae have
- With a neat, labelled diagram, describe the parts of a typical angiosperm ovule.
- With a neat diagram explain the 7-celled, 8-nucleate nature of the female gametophyte
- Draw a labeled diagram of male reproductive system.
- Draw a labeled diagram of female reproductive system.
Top CBSE CLASS XII Molecular Basis of Inheritance Questions
- Which property of DNA double helix led Watson and Crick to hypothesise semiconservative mode of DNA replication? Explain.
Briefly describe the following:
(a) Transcription
(b) Polymorphism
(c) Translation
(d) Bioinformatics
- Group the following as nitrogenous bases and nucleosides: Adenine, Cytidine, Thymine, Guanosine, Uracil and Cytosine.
- If a double standard DNA has 20 per cent of cytosine calculate the per cent of adenine in the DNA.
If the sequence of the coding strand in a transcription unit is written as follows:
5-ATGCATGCATGCATGCATGCATGCATGC-3
Write down the sequence of mRNA.
Top CBSE CLASS XII Questions
- 2, b, c are in A.P. and the range of determinant $\begin{vmatrix}1&1&1\\ 2&b&c\\ 4&b^{2}&c^{2}\end{vmatrix}$ is [2, 16]. Then find range of c is
- A boy of mass 50 kg is standing at one end of a, boat of length 9 m and mass 400 kg. He runs to the other, end. The distance through which the centre of mass of the boat boy system moves is
- A capillary tube of radius r is dipped inside a large vessel of water. The mass of water raised above water level is M. If the radius of capillary is doubled, the mass of water inside capillary will be
- A circular disc is rotating about its own axis. An external opposing torque 0.02 Nm is applied on the disc by which it comes rest in 5 seconds. The initial angular momentum of disc is
- A circular disc is rotating about its own axis at uniform angular velocity \(\omega.\) The disc is subjected to uniform angular retardation by which its angular velocity is decreased to \(\frac {\omega}{2}\) during 120 rotations. The number of rotations further made by it before coming to rest is
Concepts Used:
Transcription
The very first stage of gene expression is the procedure of transcription. In this procedure, mRNA is the place where the genetic information is stored which later aids in encoding a protein. In this process, the DNA strand acts as a guide in the making of mRNA. Despite the fact that there is one exception which is adenine base pairs with uracil instead of thymine.
Transcription Unit:
The transcription unit is a set of freshly combined RNA molecules that have been transcribed from DNA. The cause is to encode at least one gene. A protein that has been encoded or encrypted with a DNA transcription unit may have a coding sequence. Transcription has a lower copying fidelity rate when differentiated from DNA replication.
The Stages of Transcription:
The procedure of transcription is enzymatically catalyzed into three steps:
- Initiation
- Elongation
- Termination