If the sequence of one strand of DNA is written as follows:
5'-ATGCATGCATGCATGCATGCATGCATGC-3'
Write down the sequence of complementary strand in 5'→3' direction
The DNA strands are complementary to each other with respect to base sequence. Hence, if the sequence of one strand of DNA is
5'- ATGCATGCATGCATGCATGCATGCATGC − 3’
Then, the sequence of complementary strand in 5' to 3' direction will be
3'- TACGTACGTACGTACGTACGTACGTACG − 5’
Therefore, the sequence of nucleotides on DNA polypeptide in 5' to 3' direction is
5'- GCATGCATGCATGCATGCATGCATGCAT− 3’
Study the diagram given below and answer the questions that follow.
The diagram below shows DNA banding patterns obtained after DNA samples collected from a crime scene were subjected to gel electrophoresis. Samples from crime scene are denoted by C and three suspects are represented by Sı, S2, S3.
A racing track is built around an elliptical ground whose equation is given by \[ 9x^2 + 16y^2 = 144 \] The width of the track is \(3\) m as shown. Based on the given information answer the following: 
(i) Express \(y\) as a function of \(x\) from the given equation of ellipse.
(ii) Integrate the function obtained in (i) with respect to \(x\).
(iii)(a) Find the area of the region enclosed within the elliptical ground excluding the track using integration.
OR
(iii)(b) Write the coordinates of the points \(P\) and \(Q\) where the outer edge of the track cuts \(x\)-axis and \(y\)-axis in first quadrant and find the area of triangle formed by points \(P,O,Q\).
The very first stage of gene expression is the procedure of transcription. In this procedure, mRNA is the place where the genetic information is stored which later aids in encoding a protein. In this process, the DNA strand acts as a guide in the making of mRNA. Despite the fact that there is one exception which is adenine base pairs with uracil instead of thymine.
The transcription unit is a set of freshly combined RNA molecules that have been transcribed from DNA. The cause is to encode at least one gene. A protein that has been encoded or encrypted with a DNA transcription unit may have a coding sequence. Transcription has a lower copying fidelity rate when differentiated from DNA replication.
The procedure of transcription is enzymatically catalyzed into three steps: