i. Diagram: Diagram of DNA replication fork.
ii. Amino Acid Count:
Start codon: AUG (position 7–9). Stop codon: UAG (position 28–30).
Coding region: AUGGAGAUGACGACAAAAUUUUACUAG (21 nucleotides).
Number of codons = \( 21 \div 3 = 7 \).
Subtract stop codon (not translated): 6 amino acids.
Answer: i. Diagram labels Leading Strand, Lagging Strand, Replication Fork; ii. 6 amino acids.
Match the RNA type with its function. 
Match the enzyme with its function. 