List of top Questions asked in NEET (UG)- 2023

Which of the following are NOT under the control of thyroid hormone?

  1. Maintenance of water and electrolyte balance
  2. Regulation of basal metabolic rate
  3. Normal rhythm of sleep-wake cycle
  4. Development of immune system
  5. Support the process of RBCs formation

Choose the correct answer from the options given below:

The unique mammalian characteristics are:
Which of the following statements are correct regarding skeletal muscle?
  1. Muscle bundles are held together by collagenous connective tissue layer called fascicle.
  2. Sarcoplasmic reticulum of muscle fibre is a store house of calcium ions.
  3. Striated appearance of skeletal muscle fibre is due to distribution pattern of actin and myosin proteins.
  4. M line is considered as functional unit of contraction called sarcomere.
Choose the most appropriate answer from the options given below:

Which of the following statements are correct?

  1. Basophils are most abundant cells of the total WBCs
  2. Basophils secrete histamine, serotonin and heparin
  3. Basophils are involved in inflammatory response
  4. Basophils have kidney shaped nucleus
  5. Basophils are agranulocytes

Choose the correct answer from the options given below:

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?

Match List I with List II. 

 

List I

 

List II

AMast cellsICiliated epithelium
BInner surfaceIIAreolar connective tissue Of bronchiole
CBloodIIICuboidal epithelium
DTubular parts IVSpecialised connective tissue of nephron

Choose the correct answer from the options give below:

In cockroach, excretion is brought about by
A. Phallic gland
B. Uricose gland
C. Nephrocytes
D. Fat body
E. Collaterial glands
Main steps in the formation of Recombinant DNA are given below. Arrange these steps in a correct sequence.
A. Insertion of recombinant DNA into the host cell
B. Cutting of DNA at specific location by restriction enzyme
C. Isolation of desired DNA fragment
D. Amplification of gene of interest using PCR
Choose the correct answer from the options given below:

Which of the following statements are correct regarding female reproductive cycle?

  1. In non-primate mammals cyclical changes during reproduction are called oestrus cycle.
  2. First menstrual cycle begins at puberty and is called menopause.
  3. Lack of menstruation may be indicative of pregnancy.
  4. Cyclic menstruation extends between menarche and menopause.

Choose the most appropriate answer from the options given below

Given below are two statements: one is labelled as Assertion A and other is labelled as Reason R.
Assertion A: Amniocentesis for sex determination is one of the strategies of Reproductive and Child Health Care Programme.
Reason R: Ban on amniocentesis checks increasing menace of female foeticide.
In the light of the above statements, choose the correct answer from the options given below
Which one of the following statements is NOT correct?
What is the correct expression for enthalpy?
The half life of a radioactive substance is 20 minutes. In how much time the activity of substance drops to \((\frac{1}{16})^{th}\) of its initial value?
The phenomenon of pleiotropism refers to
The thickness of ozone in a column of air in the atmosphere is measured in terms of:
A carnot engine has an efficiency of 50% when its source is at a temperature 327°C. The temperature of the sink is:

The equivalent capacitance of the system shown in the following circuit is:

equivalent capacitance

The net magnetic flux through any closed surface is:
The minimum wavelength of X-rays produced by an electron accelerated through a potential difference of V volts is proportional to:
The errors in the measurement which arise due to unpredictable fluctuations in temperature and voltage supply are:
If \(∮_s\overrightarrow{E}.\overrightarrow{dS}=0\) over a surface, then:
Which amongst the following molecules on polymerization produces neoprene?

Match List I with List II.

 List-I List-II
(a)Gene ‘a’(i)β-galactosidase
(b)Gene ‘y’(ii)Transacetylase
(c)Gene ‘i’(iii)Permease
(d)Gene ‘z’(iv)Repressor protein

Choose the correct answer from the options given below:

Which among the following option is the correct graphical representation of Boyle's Law?

The effective resistance of a parallel connection that consists of four wires of equal length, equal area of cross-section, and same material is 0.25 Ω. What will be the effective resistance if they are connected in series?