Step 1: Identifying the Coding Sequence: The given sequence contains the start codon (AUG) and a termination codon (UAA). The coding sequence starts at AUG and ends at UAA.
Step 2: Calculating the Number of Codons: The sequence from the start codon AUG to the termination codon UAA is: AUGGCGUCGCUACGUCGCGCUCACGCGGACGAUCGUACGUA This sequence contains 14 codons.
Step 3: Calculating the Molecular Mass: Given that each amino acid has an average molecular mass of 110 daltons and recognizing that the termination codon does not contribute to the amino acid count, the calculation is as follows: [ {Number of amino acids} times 110 , {daltons/amino acid} = 14 times 110 ]
Result: [ {Total molecular mass} = 1540 , {daltons} ] Conclusion:
Explanation: The translation of the nucleotide sequence results in a polypeptide of 14 amino acids. Given the average mass of an amino acid, the total mass of the polypeptide is calculated as 1540 daltons.

